Beer

A Federal Judge Says Anheuser-Busch Can't Advertise MillerCoors' Use of Corn Syrup

This is bending the Lanham Act until it nearly breaks

|

One of the best things about the otherwise tedious Super Bowl broadcast earlier this year was the debut of a mildly amusing, medieval-themed Bud Light beer commercial that attacked rivals Miller Lite and Coors Light over the latter two's use of corn syrup as an ingredient in their respective brewing processes.

"Bud Light," one such ad closes. "Brewed with no corn syrup."

That is, by all accounts, a true statement. But it's also one that helped spur MillerCoors, which brews (as its name implies) Miller Lite and Coors Light, to file a federal lawsuit in Wisconsin against Bud Light brewer Anheuser-Busch.

The Bud Light ad, court documents state, "claims that Miller Lite and Coors Light are 'made with' or 'brewed with' corn syrup." All parties to the lawsuit agree that MillerCoors uses corn syrup as an ingredient in brewing both Miller Lite and Coors Light.

The crux of MillerCoors's claims against Anheuser-Busch, then, is that "when viewed as a whole, [the advertisements] deceive[] consumers into believing that Miller Lite and Coors Light final products actually contain corn syrup and thus are unhealthy and inferior to Bud Light."

Corn syrup, a glucose-based sugar, has become a much-derided food ingredient. That's due to the fact it's a type of sugar but, more so, to its relation to high fructose corn syrup (also known as HFCS, a sweeter mix of glucose and fructose). Indeed, MillerCoors claims Bud Light is using the relationship to "exploit or further misconceptions about corn syrup and high fructose corn syrup."

The MillerCoors complaint also claims in part that Bud Light "fails to inform consumers" that Miller Lite and Coors Light don't brew beer with HFCS and that when consumers buy Miller Lite or Coors Light, the products they buy contain no corn syrup.

The MillerCoors complaint centers on a deceptive-advertising claim under the federal Lanham Act. The basic premise underlying the Lanham Act's application here is that if a company's communications (advertising, marketing, packaging, and the like) intentionally mislead the public in such a way that harms that company's competitor(s), then the competitor(s) may seek redress under the law.

MillerCoors has asked the court to issue an injunction and award monetary damages.

In May, U.S. District Court Judge William M. Conley granted some of what MillerCoors has sought. He issued a preliminary injunction that barred Budweiser from implying in its advertising that Miller Lite—as sold to consumers—contains corn syrup.

Now, in a brief order issued last week, Judge Conley has upped the ante, extending his injunction to Bud Light's packaging, which has included the words "no corn syrup" printed on packaging and store displays.

"With this ruling, we are holding Bud Light accountable for their actions, and we will keep holding their feet to the fire every time they intentionally mislead the American public," MillerCoors CEO Gavin Hattersley said in a statement that was reported by The New York Times last week.

Anheuser-Busch, hardly cowed, immediately appealed the ruling and debuted two new ads.

"MillerCoors[] has publicly acknowledged that Miller Lite and Coors Light are both brewed with corn syrup," a company spokesperson said in the wake of the ruling. "We publicly acknowledge that Bud Light is brewed with no corn syrup. These are simply the facts on which everyone agrees. Not only are we appealing this decision, we will continue providing consumers with the transparency they demand, including by informing beer drinkers that Bud Light is brewed with no corn syrup." 

University of Pennsylvania Professor Yoram Wind, an expert hired by MillerCoors to study the impact of the Bud Light advertisements on consumers, noted that most of his study participants who saw an ad believed both that Miller Lite and Coors Light use corn syrup in the brewing process and that there is "corn syrup in the Miller Lite and Coors Light you drink."

Did Bud Light intentionally mislead consumers by making truthful statements? The court has said the strongest argument made by MillerCoors is that the record shows Anheuser-Busch "was both aware of and intended to exploit consumer concerns about corn syrup (and high fructose corn syrup in particular)."

Any such confusion appears to have been stoked thanks to comments made by senior Anheuser-Busch staffers. Andy Goeler, head of marketing for Bud Light, said in discussing the ad campaign that "consumers generally don't differentiate between high fructose corn syrup and corn syrup, and that it is a major triggering point in choosing brands to purchase." Another senior Anheuser-Busch official, the lawsuit states, said beer drinkers don't want to "put[] something like corn syrup, if they had a choice, into their body."

Those comments are undoubtedly disingenuous, a defect the Bud Light ad itself also suffers from. After all, other beers, ciders, and beverages produced by Anheuser-Busch do, in fact, contain corn syrup.

There's little doubt Bud Light is capitalizing on consumers' growing aversion to HFCS. But is that against the law? Why shouldn't Bud Light use truthful statements to mock its competitors if it so chooses? Sure, the cans of Miller Lite and Coors Light your dad buys contain neither HFCS nor corn syrup. But they're both brewed with the latter. That is factually true. Was the Lanham Act really intended to prohibit literally true statements, to punish those companies that make such statements, and to protect companies that feel victimized by the truth? I think not.

That's why this case borders on the preposterous. If anything, MillerCoors should direct its ire (if not its attorneys) at the senior Anheuser-Busch employees who may or may not have disparaged Miller Lite and Coors Light. Better still, MillerCoors should take its fight with Bud Light to the court of public opinion. Instead of complaining about Bud Light's ads, MillerCoors should respond with a campaign of its own. Hopefully, they'll see the lite.

NEXT: Bonding

Editor's Note: We invite comments and request that they be civil and on-topic. We do not moderate or assume any responsibility for comments, which are owned by the readers who post them. Comments do not represent the views of Reason.com or Reason Foundation. We reserve the right to delete any comment for any reason at any time. Report abuses.

  1. What’s more troubling is that consumers have been tricked into thinking that any of these are palatable choices in beer.

    1. Beat me to it.

    2. Seriously. In Norfolk, VA, there is a certain odor at low tide. Budweiser gave that odor a flavor and bottled it. Fuck AB/Inbev.

    3. nothing like a good new fashioned microbrew double IPA

    4. Eric Idle joke: “How is American beer like having sex in a canoe? They’re both fucking close to water”

    5. Setting aside your rants about “elitism” long enough to look down your noses at the beers most Americans prefer, clingers?

      1. There’s a difference between looking down one’s nose at what one sees as an inferior product compared to looking down one’s nose at what one sees as an inferior person, churl.

  2. Of course the truth should be illegal.
    How else are democrats going to take over again?

    1. Should deception be illegal?

      we will continue providing consumers with the transparency they demand, including by informing beer drinkers that Bud Light is brewed with no corn syrup

      It takes a special kind of temerity to claim the halo of transparency when deliberately misleading about something.

      I don’t defend the freedom to lie in advertising. Not here. Not when banks lie their overdraft fees are to help you when it is core to their profit model. Not when cedit card companies lie your large debt is now risky so they jam up your interest rates, trapping you almost forever, when that is core to their profit model.

      Quit lying to your customers. Quit lying about what you are doing and why. Say nothing if you want to, but quit lying. “We don’t do this, wink!” Is as much a lie as “We don’t do this which is bad (which is a lie)”.

      Knowing the consumer will, by your plan, misinterpret what you say, is a lie.

      1. By law, credit card companies can only increase your rate on new debt. At least for the company I worked for, we only did it after a long period of delinquency. When an account is this delinquent, 99% of the time the time it’s written off as a loss. I wouldn’t say this is core to their profit model.

        For subprime cards, there are certain fees that are core to the profit model. Some of them require an initial deposit of the entire credit limit, while others might charge a small monthly fee. Since a lot of these accounts go delinquent, it has to be a fee based model. The types of fees and their amounts are regulated at the federal level, so there’s really no surprises. After 6-12 months of responsible use, generally these customers can get a better card.

        The only thing I do have a problem with is accumulating overdraft fees. The banks have the ability to turn off your debit card after the first overdraft, which is what the fee should be for. If you aren’t paying attention for a day or two, it’s easy to get $1000+ in overdraft fees on $100-$200 worth of purchases. It might be in the terms, but to me that is a predatory business practice.

  3. Is it quite believable that 100% of the elements of corn syrup that are put in MillerCoors brews are converted to something else during the brewing process or otherwise removed?

    1. The matter (atoms) in the corn syrup are turned into pure energy (via E = MC – squared, and Greek-Thai “fusion-food foodie-ism”) by these tiny little homunculi inside the yeast cells, see… When the pure-energy ray-beams hit the surrounding water molecules, they are immediately turned right back into matter (some of which are drunken boozy molecules).

      So yeah, the corn syrup is no longer there; it’s been turned to energy and then back to matter!

    2. Brewers have been using sugar for ages, and corn sugar is probably the most common priming sugar used by home brewers to carbonate their beer. It’s highly fermentable and I doubt any of it remains in the finished product.

    3. 100+/- 1%, probably yes. 100%+/-.0000001% definitely not.

    4. The beer nerd point ISN’T that corn syrup winds up in the beer, it’s that real beer doesn’t have corn in it (only barley, hops, yeast and water, per Reinheitsgebot). The counterclaim should be “Bud’s commercial is miselading because the fancy label brags about RICE”.

      1. the Reinheitsgebot is bullshit protectionism against competitors.

        Real beer has whatever you fucking like in it, nazi.

  4. This is like the Iran Iraq war. Rooting for both to lose.

    1. Yeah man I can relate to “rooting for both to lose”…

      My fave example of that goes back a while also… David Koresh (Whacko of Waco) v/s the BARF (ooops, I mean the BATF) and Janet Reno… Pick a side when 2 utter assholes (who apparently deserve each other) fight? Why should I?

      Also, the USA shouldn’t have lifted a SINGLE FINGER to assist Stalin against Hitler! The enemy of my enemy can still be an utterly evil asshole!

      1. Koresh was an asshole and an accused child abuser. But burning 60+ people to death was a bit of an over-reach.

        Hitler’s Germany was a much more dangerous enemy than Stalin, so we had little choice. Just imagine if the USSR had surrendered in 1943. All of Europe could be speaking German today.

    2. Methinks they are both now simply using the courts as a marketing extension

  5. Drink real beer instead of this weak swill, and the presence or lack of corn syrup won’t even be in question.

    1. The presence of corn sugar quickly made Al Capone’s cheap purchased wort into real beer–a felony count after March 2, 1929. That was the operation Eliot Ness drove the snowplow into to make a bust.

  6. Sigh….listen up Coors. If you really want to strike back, find the Achilles Heel of Budweiser and do creative advertising about it. Quit whining to Judges and get to work! There really is something to the maxim, “Truth Hurts!”. So get to it.

    I do not think it is an accident that craft beer consumption has virtually exploded in the last decade. There are some damned good craft beers out there. Lately, I have been trying out different New England style IPAs.

    1. Coors should just run ads showing shoppers picking up cases of Bud Lite and heading straight over to the toilet paper aisle to load up their cart. There, a friend asks, “Hey, Jim, why so much toilet paper?” and Jim nods at the case of Bud Lite and the friend nods knowingly and suggests maybe Jim should buy a beer that doesn’t cause explosive diarrhea.

      1. Thunderous applause

      2. we always called it butt wiper

      3. You laugh! At a Big Beer merger meeting these guys would fan out into stores to show visiting foreigners how it’s done. One pounced on some poor shopper with “the other brand” in his shopping cart, & tried to switch his sixpack! The shopper clawed onto the plastic rings and held tight, so the pusher planted “the good” sixpack in the guy’s cart, then pressed a fiver (the cost then) into his hand, grinned and called it a free sample. I could hardly this was really happening.

    2. Comparing craft beer to the likes of Bud is like comparing perfectly grilled, grass fed T-bone steak to a McDonald’s hamburger. I sometimes wonder why anyone still drinks disgusting cheap beer, and then I realize it may be intended for those who drink 6 or 12 in one evening. It’s cheap, just like a slimy grayish and mostly tasteless fast food burger.

      1. Keep your grass fed steaks. I prefer mine grain finished, with excellent marveling. Grain finished is less gamey, generally tenderer (grain finished steers are younger by 6 months on average) and has a lower environmental impact per pound of beef produced. Grass finished is the beef equivalent of being against hfcs, it is all scientific woo. It should be noted most people’s preference for grass finished is pure placebo effect. Multiple studies have shown that most who claim to prefer grass fed either can’t tell the difference of prefer grain finished in blind taste tests.

    3. “Coors: It doesn’t take 100% like Budweiser”

    4. Start calling it “rice beer.” That’s true(ish).

    5. “Lately, I have been trying out different New England style IPAs.” hay! welcome to 2003!

  7. So how much of this lawsuit is being funded by MillerCoors and how much by ConAgra? It sounds like they’re not just suing over Bud implying Coors Lite has corn syrup in it but also for the implication that even brewing it with corn syrup is bad. Maybe the Fanjuls are involved as well?

    1. makes you wonder if Big Corn got to the judge

  8. “Our beer has no fat, no gluten, *and* no soy — unlike *some* beverages.”

    1. How about: “Peanut free”

      or maybe: “Does not contain nut meat.”

    2. Most beers actually do contain gluten, since they’re brewed from barley and wheat.

  9. I’m not sure which is more stupid: the judge’s ruling in this case, or people who give a shit about consuming corn syrup vs “real” sugar.

    1. Just because corn syrup and cane sugar don’t affect you differently doesn’t mean they affect everyone else identically. I, for one, have found that drinking three or more bottles of MillerCoors beer keeps me from sleeping until my body fully metabolizes whatever the byproducts of the corn syrup are. This is why I don’t drink macrobrews anymore.

      I wish American brewers adhered to an equivalent of the Reinheitsgebot…

      Anyway, I’ll stick with microbrews or the regional beers around here. Seeing as though I live in Milwaukee, I am truly fortunate to have so many options.

    1. Always go for the version with alt text…

      https://xkcd.com/641/

  10. If Anhheuser-Busch ultimately looses the court battle, can a lawsuit be brought to remove the “Non-GMO Verified” or “organic” labels and kill all those irritating commercials that tout that whatever company’s product contains only those ingredients? I am pretty sure there are multiple articles here at Reason that go over all the reasons why nutritionally, there is no reason to care (especially about the GMO debate) and the continued advertising exploits the public’s misconceptions about GMO products (and potentially does a lot worse by limiting development of the wonderful technology that could save millions of lives and shrink our need for resources needed to create food).

    1. No misconceptions here. Their human-health effects aside, GMO foods are proving ecologically disastrous. Not only should non-GMO labeling be permitted, but contains-GMO labeling should be required, so folks who care about ecological impacts can avoid.

      1. “GMO foods are proving ecologically disastrous.”

        Yes, if you are a boll weevil or a corn-borer worm, GMOs might be a big environmental hazard for you! Otherwise, if you’re a human, GMOs might help you eat nutritious foods WITHOUT plowing down so many forests! GMOs might even save you from blindness or hunger, if your diet SUCKS as you grow up dirt-poor in a dirt-poor nation!

        But don’t worry, my sweet little tot, we can say, we in the Wealthy West are SAVING YOU from GMOs!

        1. Yeah, someone completely doesn’t understand what GMO crops are being used.

          The only claims of “ecological disaster” I’ve heard center around pollinating insects and BT toxin. The problem with this argument is the alternative is the repeated spraying of chemical pesticides in much, much higher quantities and concentrations with much less discrimination of application than an integrated BT gene.

          GMO crops are win-win-win all over the place. Better product, lower costs, less environmental impact, more productive per acre…. what’s not to love?

          1. “GMO crops are win-win-win all over the place. Better product, lower costs, less environmental impact, more productive per acre…. what’s not to love?”

            More pesticides. If you don’t want your crops treated with these chemicals, then there is little point in planting GMO.

            1. That is a falsehood. The one study looked at glyphosate use in crop on glyphosate resistant varieties and non glyphosate resistant varieties. Gee, go figure, glyphosate resistant varieties had more glyphosate applied. But when they compared all pesticides, including pre and post emergent, guess what, the glyphosate resistant varieties used less pesticides

              1. source?

              2. soldiermedic76
                September.14.2019 at 7:34 pm
                “That is a falsehood. The one study looked at glyphosate use in crop on glyphosate resistant varieties and non glyphosate resistant varieties.”
                Not sure which study to which you refer, but please do cite it so the rest of us can laugh and laugh at the fucking ludite Sir Chips Alot.
                The asshole deserves that and much more.

              3. Less pesticides? Organic farmers don’t want to use any pesticides. That’s the point of organic farming. They try to avoid any use of glyphosate,

                1. mtrueman
                  September.14.2019 at 11:30 pm
                  “Less pesticides? Organic farmers don’t want to use any pesticides. That’s the point of organic farming. They try to avoid any use of glyphosate,

                  Our resident fucking ignoramus shows up just in time!
                  Wrong, ignoramus; ‘organic’ farmers simply prefer to use the ‘pesticides’ inherent in the plants; the ones that, given what’s known as ‘evolution’ will ‘evolve’ to endanger those organisms which eat those plants: Humans.
                  Your lack of intelligence is commonly noted, asshole.

                  1. Are pesticides like that stuff you sprayed on the Vietcong because they wanted you out of their country?

                    1. “They”?

                      Oh, you mean the murderous thugs who wanted to take over for other murderous thugs atop their kleptocracy, who wanted freedom out so they could take over as the new kleptocrats.

                      Gotcha.

                    2. Well, as was the case with Iraq it was their country. Why should I pay to have some doofus who doesn’t understand the local culture go shoot up and bomb the place. Fuck that.

                    3. No, those were herbicides, which work on plants, not imsects. Completely different.

                      And now you look even dumber.

                    4. Tulpa, that is nonsense. Insects cannot eat without plants. Some insects cannot breed without specific species of plants. If we thought monarch butterflies were pests, then glyphosate would be a terrific pesticide for monarchs, because it kills milkweed, without which monarchs cannot breed.

                      In general, if you drive through glyphosate-treated acreage, and stop and get out of your car, you won’t need bug spray. You won’t see many insects at all. Nor anything else that eats insects, like many bird species, many reptile species, many mammal species. Glyphosate kills them all, by killing the plants. That is why glyphosate is an ecological catastrophe. It works as if it were a universal pesticide, for everything.

                      Across vast swaths of countryside today, natural life is basically ruled out, in favor of only genetically modified crop species. Anyone who think humans can live for long without those missing plant species, and without the bugs and other organisms which depend on them, is courting nasty shocks down the road.

                  2. Thanks for your ‘input,’

              4. Glyphosate isn’t a pesticide.

                1. Plants can be pests, just like Tulpa can be a pest. Stop trying to be the language NAZI, you pest!

                2. “Glyphosate isn’t a pesticide.”

                  Nevertheless, organic farmers don’t want it near their crops.

      2. Right. That
        TACTTAGCTAGCTACTTAAGCTCCGAATGGTGCTATGCTATGC
        base sequence is a killer.

      3. That is funny because very few competent science articles support this position. How are GMOs destroying the environment?

      4. GMO foods are proving ecologically disastrous.

        Where? Because that is certainly not happening on planet earth.

        1. Oh, and you do know that pretty much everything you eat has been genetically modified.

          Beef

          Chicken

          Corn

          Wheat

          Soy

          Green beans

          Peas

          Carrots

          1. yeah…no. where do you get such stupidity from , my low IQ fake news puppet?

            1. Sir Chips Alot
              September.14.2019 at 8:39 pm
              “yeah…no. where do you get such stupidity from , my low IQ fake news puppet?”

              From data, you pathetic piece of shit.
              Got other data? Please cite.
              And no, you don’t. Fuck off and die.

            2. Any animal science course bruh.

      5. Stephen Lathrop
        September.14.2019 at 12:49 pm
        “No misconceptions here. Their human-health effects aside, GMO foods are proving ecologically disastrous.”

        You.
        Are.
        Full.
        Of.
        Shit.

        1. no. you are a low IQ, fake news puppet. Stop being so pathetically stupid and gullible.

          1. Sir Chips Alot
            September.14.2019 at 8:40 pm
            “no. you are a low IQ, fake news puppet. Stop being so pathetically stupid and gullible.”
            No.
            You.
            Are.
            Full.
            Of.
            Shit.
            Cite or fuck off, slaver.

  11. So is it still o.k. to claim your food product is “non-gmo” or “organic?”

    1. Depends on your definition of ok.

      Legal, yes. Ethical because it relies on “wink” lies intimating it is bad, no.

  12. What do you expect from a country where products with peanut oil have to carry an allergen warning?

    1. Given that peanut allergies are deadly for many, this is simply wise lawsuit avoidance and consumer assistance.

      1. That’s why I said peanut OIL. There are no proteins (allergenic or otherwise) in peanut oil, unless it’s unrefined organic.

      2. Peanut allergies aren’t deadly for ‘many’. Peanut allergies are actually incredibly rare. Otherwise a significant minority of the population would have been dropping dead for the last couple hundred years and something would have been done about it before the year 2000.

      3. Just so long as the lawyers get paid.

  13. I would never drink rice-beer (Bud) or corn-beer (Coors), they are both abominations. I only drink beer-beer. The Germans (of course) have a word for this: bierernst or beer-serious.

    1. German beers are piss water. American IPAs rule the world.

  14. Someone needs to warn Miller about the Streisand Effect…

  15. Warning people about Coors Light should be considered a public service.

    1. I miss the days when taking Coors east of Texas was bootlegging.

      1. “East-bound and down.”

  16. Could have been worse. They could have warned that Coors is using a gasoline additive in their beer.

  17. “Sure, the cans of Miller Lite and Coors Light your dad buys contain neither HFCS nor corn syrup.”

    Looks down nose, rolls eyes, and feels oh so superior to the old racist-sexist-homophobic dinosaur.

    1. Good point. I thought your dad bough Miller. Just Miller. Or Pabst.

      No light. No cutsie abbreviations.

      My generation drinks distilled beverages. Single malt. Neat. With a fancy cigar for a while, but that fell out of favor.

      The kids these days have taken over my generation’s home brew fad and decided that as long as you stuff the entire batch full of as much hops as will physically fit into the vat, it is a delicious brew.

  18. I don’t always drink beer, but when I do, it’s not Bud. Or Coors or Miller, for that matter.

    And Bud Light is brewed with rice. I’ll take the HFCS.

    1. I drink bud light because it’s the least bitter beer I’ve ever found and I’m a wimp. But I admit to that.

  19. “Anheuser-Busch?”

    “Fine, how’s yours?”

    1. “Oh, how gauche!”

      “Oh pretty goodlish… And how goes-it with you?”

  20. Is the Bud Light ad in the corner of this page the real reason for this article?

    1. An impression that won’t lead to a sale.

  21. It must be difficult to grasp for aspies, but language depends on context and interpretation and the law needs to reflect that. “When did you stop beating your wife?” is “just a question”, but nevertheless could be libelous.

    1. Gee, thanks for labeling all of us on the spectrum as defective. Fuck off nimrod.

    2. OK then, yes…

      HAVE you stopped beating your wife yet?!? Yes or no, yes or no!?!?

      The asking of a binary question, with NO other choices allowed, is a CLASSICAL tactic of authoritarians! So… NOYB2… Are ye a worshipper of The Donald Trump, and The Donald’s draconian border enforcement tactics, or are ye… ARE YE A COMMUNIST?!?! Which is it, it’s got to be one or the other!?!?!

      Bill Clinton perfected this art LONG ago… See https://reason.com/1998/05/01/getting-beyond-racism/ for example…

      So anyway… Have you stopped beating your wife yet? Yes or no?

      1. Yes, Whihno, when he said aspie, he meant you.

  22. “Drug company attorneys seek to disqualify federal judge”
    […]
    “The attorneys wrote that Polster has made comments during hearings, media interviews and public forums about the importance of getting help to governments struggling to contain a crisis that has killed 400,000 people nationally since 2000.
    […]
    “The attorneys say Polster’s comments about his intentions to get plaintiffs help during hearings, media interviews and public forums are evidence of his bias and prejudice. They cited a remark made during the first court hearing in January 2018 for the multidistrict litigation when Polster said, “My objective is to do something meaningful to abate the crisis and to do it in 2018.”
    The motion said: “Under settled law, any one of these statements would be enough to cause a reasonable person to question a judge’s impartiality.”
    https://www.latimes.com/world-nation/story/2019-09-14/opioid-trial-disqualify-judge-dan-polster

    Guy needs to go back to chasing ambulances.

    1. Those evil drug companies, trying to fight back against getting raped by the government. If they didn’t want to get raped, they shouldn’t have been walking around with all that money.

  23. This kind of sniping goes back over a century. There was the arsenic poisoning in England, then the Glucose Trust investigations of 1916, when the trust was buying 18th Amendment votes. The War on Beer led in 1924 to development of anhydrous glucose corn sugar which became the solution for bootleg neutral spirits. Boxcar loads of corn sugar led the feds to raids, asset forfeiture, freezing bank accounts, Crash, Depression–so brewers started calling it HFCS. Then the food cranks attacked and now they are back to calling it corn sugar.

  24. Too late . We already know about it.

  25. Coors should have just responded with “at least our beer isn’t ricewater”

  26. I’m not sure the article’s point about the Lanham Act (the Court “bending” it) is quite right. Truth is a defense to defamation, but a false advertising claim under the Lanham Act is not a defamation claim (I agree that there are some obvious superficial similarities).

    The primarily goal of the Act is to protect consumers, though competitors clearly have standing to bring false advertising claims. If AB’s advertising is affirmatively creating misconceptions about competitor products among consumers, and those misconceptions in turn lead consumers to eschew products they might otherwise purchase, it’s not obvious to me why AB’s advertising shouldn’t be actionable, even assuming that the advertising statements are in some form or fashion technically “true.”

    In other words, I’m not sure technical truth should be dispositive when a company knows that using technically true statements in its advertising will create a misconception among consumers that impacts consumer purchasing decisions to the detriment of competitors. It seems to me such outcomes are precisely what the Lanham Act is aimed at preventing.

    All that said, though, I agree with what I read to be the article’s overall sentiment (i.e. there is something suspicious about creating liability based on statements that have some demonstrable truth). My sense is that the proper way to resolve such claims is for the court to scrutinize certain evidence more carefully.

  27. Who cares if its Bud Light, Miller Lite or Coors Light. All three taste like crap.

    1. Go for the Bud or Coors. If only for the spelling.

  28. I thought it was carbonated water mixed with the piss of some lesser mammal, like a raccoon.

  29. I’ve not looked through the decision. But, I wonder if there’s a sentence or two in the decision that AB could quote in their ads with a reference to “No. 19-cv-218-wmc. United States District Court, W.D. Wisconsin” that explains that MB uses corn syrup in its brewing process. This would just be an educational/informational ad of course that calls attention to recent court decisions. What could be wrong with such a noble educational cause?

Please to post comments

Comments are closed.