Reason Magazine

Get Reason E-mail Updates!

Manage your Reason e-mail list subscriptions

Site comments/questions:

Media Inquiries and Reprint Permissions:


(310) 367-6109

Editorial & Production Offices:

3415 S. Sepulveda Blvd.
Suite 400
Los Angeles, CA 90034
(310) 391-2245

advertisements

Print|Email

Personal Genome Project Launches Today—Wanna Sign Up?

The Personal Genome Project launches today. Visitors can take a look at the genetic information of such luminaries as Harvard psycholinguist Steven Pinker and tech venture capitalist Esther Dyson. The project website explains:

We believe individuals from the general public have a vital role to play in making personal genomes useful. We are recruiting volunteers who are willing to share their genome sequence and many types of personal information with the research community and the general public, so that together we will be better able to advance our understanding of genetic and environmental contributions to human traits and to improve our ability to diagnose, treat, and prevent illness.

What's more the project is looking to sign up 100,000 individuals who agree to let their genetic information be posted on the internet where researchers can mine it for genetic links to disease and health. As the New York Times reports:

The goal of the controversial project, which hopes to expand to 100,000 participants, is to speed medical research by dispensing with the elaborate precautions traditionally taken to protect the privacy of human subjects. In exchange for the decoding of their DNA, participants agree to make it available to all — along with photographs, their disease histories, allergies, heights, weights, medications, ethnic backgrounds and a trove of other traits, called phenotypes, from food preferences to television viewing habits.

Collecting phenotypes, which other genetic databases have avoided in deference to privacy concerns, should allow researchers to more easily discover how genes and traits are linked. Because the "PGP 10," as they call themselves, agreed to forfeit their privacy, any researcher can mine the data, rather than just a small group with the proper clearance.

But the project is as much a social experiment as a scientific one. "We don't yet know the consequences of having one's genome out in the open, but it's worth exploring," said George M. Church, a geneticist at Harvard who is the project's leader and one of its first subjects.

A new federal law prohibits health insurers and employers from discriminating against individuals on the basis of their genetic profile. But any one of the PGP 10 could be denied life insurance, long-term care insurance or disability insurance, with no legal penalty.

Because of the risks, Church required the first 10 participants to demonstrate the equivalent of a master's degree in genetics. Most are either investors or executives in the biomedical industry, or else teach or write about it, so they may have a financial interest in encouraging people to part with their genetic privacy.

The project has drawn criticism from scientists and bioethicists who caution that even its highly educated volunteers cannot understand the practical and psychological risks of disclosing information long regarded as private.

"I'm concerned that this could make it seem easy and cool to put your information out there when there is still a lot of stigma associated with certain genetic traits," said Kathy Hudson, director of the Genetics and Public Policy Center at Johns Hopkins University. "There will be new uses of this data that people can't anticipate — and they can't do anything to get it back."

Go here for the Personal Genome Project's website and maybe even sign up. 

|10.20.08 @ 11:31AM|

I sent them a email wanting to sign up....curious to see if I get a response

|10.20.08 @ 11:32AM|

p.s.

Steven Pinker's book "The Blank Slate" on of the better books I have read recently.

|10.20.08 @ 11:45AM|

My mother got all teary-eyed when I told her that I was going to have my DNA checked. Then she said something about sparing Dad the news.

Guy Montag|10.20.08 @ 11:54AM|

I am so giddy from voting Libertarian just now that I read the headline as "Gnome" and was wondering what is so special about yard ornaments.

Off to post me vote!

|10.20.08 @ 11:56AM|

Can't wait to find out....

LarryA|10.20.08 @ 12:05PM|

I can see it coming. G-Harmony.com

Dello|10.20.08 @ 12:33PM|

First thought is: Why not do this in England? The Brits already track every aspect of everybody anyway...

Second thought is: How long before employers start checking your G-Book page to find out if they want to hire you? "Dude! Guess what I was prepisposed to do last night! Even though I didn't!!"

No more thought for me today.

TallDave|10.20.08 @ 12:49PM|

It will be worth it if they can isolate the socialist gene.

Preferably on an island somewhere.

|10.20.08 @ 1:28PM|

"The project has drawn criticism from scientists and bioethicists who caution that even its highly educated volunteers cannot understand the practical and psychological risks of disclosing information long regarded as private."
I fully expect that when the chicks see my huge string of GCAAAATTCGTACATGGTCA's that I will be getting more supermodel actual than anyone, except me, deserves.

|10.20.08 @ 2:10PM|

I have been leaving samples of my genetic material in random locations for years...

LarryA|10.20.08 @ 5:21PM|

The project has drawn criticism from scientists and bioethicists who caution that even its highly educated volunteers cannot understand the practical and psychological risks of disclosing information long regarded as private.

Quibble: Before genetic testing the information wasn't "private." It was largely unavailable.

Typical "We know better than you" response. That's the gene I'd like to deselect.

BlueBook|10.20.08 @ 5:35PM|

Why not do this in England?

We have learned all that we can from the "horrible teeth" genomes.

(Actually, while sometimes over-hyped, America probably does have greater genetic diversity than just about any other region on Earth.)

Nigel Watt|10.21.08 @ 12:15AM|

(Actually, while sometimes over-hyped, America probably does have greater genetic diversity than just about any other region on Earth.)



Try Africa.

Leave a Comment

advertisements