It's Alive! It's Alive! (OK, Not Yet, But Pretty Soon)

Ronald Bailey | January 25, 2008

Private genome sequencer Craig Venter and his colleagues announced yesterday that they had recreated the entire genome of a bacterium using off-the-shelf chemicals. They have not yet installed this lab-created genome into a bacterial cell to see if it will boot up, but hope to do so later this year. The bacterial genome is from Mycoplasma genitalium which has the smallest known genome--just over 580,000 base pairs of DNA--of any free living organism (and which incidentally was the second genome of a free living organism ever sequenced by Venter way back in 1995). Venter argues that today'a achievement is a step toward synthetic biology in which researchers can endow living things with novel genetic programs to produce a wide variety of useful substances. Among other things, Venter wants to create bacteria that can transform plant material into hydrocarbon fuels.

Other teams are working on the same goal by tinkering with the genomes of various bacteria to produce biofuels like butanol. Naturally, anti-technology and anti-corporate activist groups are calling for a moratorium on the research.

Fun addendum: The New York Times notes:

The team also added some DNA segments to the genome to serve as “watermarks,” allowing scientists to distinguish the synthetic genome from the natural one.

That raises new possibilities of using microbes as a method of communication. Dr. Venter said the watermarks contain coded messages. Sleuths will have to determine the amino acid sequence coded for by the watermarks, in order to decipher the message. “It’s a fun thing that has a practical application,” he said.

Of course, as I reported back in 2000, artists have already done something similar. At a show at the Exit Art gallery entitled "Paradise Now: Picturing the Genetic Revolution," artist Eduardo Kac created a fascinating installation which featured bacteria with an added "art gene." Here's what Kac did:

Take the installation Genesis, by Brazilian-born, Chicago-based artist Eduardo Kac. Upon walking into a darkened room, viewers see a large circle of light on the far wall—the projected image from a micro-video camera of a bacteria-laden petri dish in the center of the room. On the other walls glow various texts, including a verse from Genesis: "Let man have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moves over the earth." On a different wall, Kac has translated the Bible verse into the dots and dashes of the first electronic language, Morse code. He then translates the Morse code into the ACGTs of the genetic code, assigning word spaces to adenine, dots to cytosine, letter spaces to guanine, and dashes to thymine. The "art gene" version of Genesis is actually produced by stringing these DNA bases together. Then the DNA bases are inserted into the living E. coli bacteria in the petri dish that viewers see projected before them. By activating an ultraviolet light over the petri dish, viewers can cause the bacteria to mutate, thus becoming co-creators with Kac.

Any speculation on what Venter's encoded message may say?

Help Reason celebrate its next 40 years. Donate Now!

Try Reason's award-winning print edition today! Your first issue is FREE if you are not completely satisfied.

|1.25.08 @ 10:17AM|#

I've never heard of the ETC, but this story got a nice shout out on DailyKos.

cooooool dude

|1.25.08 @ 10:19AM|#

"ETC Group today renewed its call for a moratorium on the release and commercialization of synthetic organisms, asserting that societal debate on the oversight of synthetic biology is urgently overdue."

Translation: ETC thinks this is icky, and they need some time to drum up some BS controversy.

|1.25.08 @ 10:23AM|#

So is it possible to extract the genome from something like, say, a stuffed dodo? I wouldn't mind a few of those coming back.

|1.25.08 @ 10:26AM|#

I want to bring back the Mammouth. Get giant furry elefants running all over the plains again. Be able to go all caveman and have Mammouth steaks.

On serious note, this does kind of scare the hell out of me in some ways. How long are we from the day where anyone with a graduate degree in biology can create his own killer bacteria in his garage lab from materials bought off the internet? A long time, I hope.

|1.25.08 @ 10:28AM|#

Bring it on.

Josiah|1.25.08 @ 10:28AM|#

We just have to hope someone else can create a killer bacteria killer.

|1.25.08 @ 10:29AM|#

That's interesting, Jake. Maybe put the eggs into the nests of similar birds.

robc|1.25.08 @ 10:30AM|#

John,

Its a long time away. Just think of computer advances. Is the computer in your phone really that much more advanced than 1970s era mainframes. Uh, oh, crap. Well, Im sure we still have 10-15 yars or so.

yars

Okay, obvious typo. But maybe an Atari game does hold the answer.

kinnath|1.25.08 @ 10:34AM|#

A long time, I hope.

More likely within our lifetimes.

GILMORE|1.25.08 @ 10:39AM|#

There's already a company that produces biofuels with engineered backteria = Amyris Biosciences in Berkley CA.

http://www.amyrisbiotech.com/projects_biofuels.html

I believe their "plant material" is sugar cane fiber or something like that

Bill Gates funded them to produce anti-malarial drugs, and they found they could produce butanol and ethanol using similar processes. Note that the CEO is from a fuel company, while most everyone else on the board is a PhD biologist

I only know this because ive done some work for them, but i believe they are well covered in the press. I remember the economist did a roundup a while back on the companies out there in CA who are engineering bugs to make biofuels

Mike Laursen|1.25.08 @ 10:48AM|#

Serious question: When they say that they've sequenced the human genome, for example, does that mean they've sequenced a particular human's genome (say, using a sample of Venter's DNA as a stand in for the entire human race), a few different humans, or are they claiming they have sequenced the genetics of all humans? This seems like an obvious question to me, but I can never find any discussion of it.

Jesse Walker|1.25.08 @ 10:49AM|#

Any speculation on what Venter's encoded message may say?

I think the upshot will be, "If civilization collapses but these organisms continue to thrive, and then our descendants laboriously rediscover modern science, and then they find this message, they are totally going to believe in God."

Episiarch|1.25.08 @ 10:50AM|#

Any speculation on what Venter's encoded message may say?

"Get a life, bio-dorks?"

Episiarch|1.25.08 @ 10:52AM|#

So is it possible to extract the genome from something like, say, a stuffed dodo? I wouldn't mind a few of those coming back.

There's this movie, see...it involves dinosaurs and Spielberg was involved. That tells you all you need to know about what will happen if your idea is pursued. Science is evil--don't you know that?

robc|1.25.08 @ 10:52AM|#

they are totally going to believe in God.

Get a life, bio-dorks

An interesting God.

the innominate one|1.25.08 @ 10:54AM|#

Jesse: Ha!

I think Venter's message will be: "Craig Venter is the greatest!"

Mike: at the moment, a few different humans have been completely sequenced, including Venter and James Watson. Certainly not all humans. Have you given a sample?

T|1.25.08 @ 10:57AM|#

Any speculation on what Venter's encoded message may say?

Probably something horribly prosaic like "This organism copyright 20008 Synthetic Genomics. All rights reserved."

Although something along the lines of "Congratulations! You found the secret message! To claim your prize, send proof of purchase and 16.95 for shipping and handling to ..." would be pretty funny. Especially if the prize was, I dunno, a bio of Craig Venter or something similarly self-serving.

|1.25.08 @ 10:58AM|#

"How long are we from the day where anyone with a graduate degree in biology can create his own killer bacteria in his garage lab from materials bought off the internet?"

Perhaps another reason why no one from the future has developed time travel and come back to chat. Dead from manufactured viruses.

Any speculation on what Venter's encoded message may say?

"What hath man wrought" comes to mind.

robc|1.25.08 @ 11:12AM|#

So what are the odds of the added on message mutating and becoming an active gene that does something?

|1.25.08 @ 11:21AM|#

Any speculation on what Venter's encoded message may say?

All your bases are belong to us!

Only people who hate science, and thus humanity, worry about things like that, robc.

robc|1.25.08 @ 11:24AM|#

joe,

I was just wondering the odds. Personally Im cheering for it, it could be cool.

|1.25.08 @ 11:25AM|#

Episiarch,
Damn you! You beat me to it.

Ramsey|1.25.08 @ 11:27AM|#

I really hope that the advances occur fast enough that we can engineer humans to have an improved innate resistance to any designer bacteria or viruses that might be created.

I would also like super sight, hearing, strength, speed, and intelligence while they are at it. Hell, throw in the ability to survive in a vacuum and strap me on a rocket to mars.

If we survive the (potential) coming biological agents long enough to remove the weaknesses of evolution from humanity it might be a great time to be alive.

Episiarch|1.25.08 @ 11:30AM|#

So what are the odds of the added on message mutating and becoming an active gene that does something?

Pretty much zero. Your cells are constantly having their DNA knocked around and 99.999999999% of the time it results in nothing or the death of the cell. The rest? Cancer.

|1.25.08 @ 11:35AM|#

I have to admit, the part that shocked me was the end; I mean, conceptual art that isn't rabidly anti-modern? Who knew.

Killer bacteria = No more man made global warming.

That's a good thing, huh Ron?

The Wine Commonsewer|1.25.08 @ 11:45AM|#

NoStar and I think a lot alike.

Stuff like this is exactly why I never worry about Global Warming or the cost of gasoline.

|1.25.08 @ 11:53AM|#

So is it possible to extract the genome from something like, say, a stuffed dodo? I wouldn't mind a few of those coming back.

I want the passenger pigeon back, myself.

Episiarch|1.25.08 @ 11:54AM|#

I want the passenger pigeon back, myself.

Yes, so I can kill them all again. HA HA HA HA

|1.25.08 @ 11:57AM|#

Look up the etymology of the term "stool pigeon". You'll be sad for hours afterward.

|1.25.08 @ 12:02PM|#

John, I hate to break it to you, but any first-year microbiology grad student who's worth her salt can make a killer bacterium from materials bought off the internet or from the department's chemstores. The barriers are merely logistical - if the student's department has no level IV laboratories, for instance. I certainly never would have wanted to make a superbug on my benchtop because I'd not have survived :)

Likewise, I'd not do it in my garage or basement.

Then again, hoods and personal protective gear are available, so one could certainly try it at home if they have the budget.

As to who's been sequenced, that's already been answered. I'll just add that thousands of people have had their genomes partially sequenced but in the end, an entire genome sequence isn't all that useful anymore. We've all got the same Unabridged Dictionary in our nuclei. The informative aspects of our individuality is in the typographical errors.

So instead of sequencing someone's entire genome, or even an entire gene, we can look for a specific typo.

It's much easier that way.

|1.25.08 @ 12:04PM|#

are.

aspects of our individuality are in the typographical errors...

but you know what I meant.

|1.25.08 @ 12:07PM|#

You did that on purpose, Bronwyn.

From The Keystrokes of John Q.|1.25.08 @ 12:15PM|#

Now all we need to do is engineer a fuel that can compete with oil not only for energy output but from the incredibly cheap cost of wellhead production... sitting around $10.00 a barrel. Oh wait freemarkets are evil and the government needs to create all the solutions.

hj|1.25.08 @ 12:26PM|#

The odds of the added on message becoming anything is practically nil.

If they are not idiots, they will make sure it does not get expressed as protein. Even if it does get expressed as protein, it would be practically mathematically impossible for some worded message to become a proetin that folds, has proper solubility, and some sort of enzymatic property. Monkeys and Shakespeare and all that.

People have been genetically engineering bacteria for cellulosic ethanol or other purposes for a while, what this new process suggests is that soon instead of just adding and subtracting a few genes, now genetic engineers can save a lot of time and effort by simply booting up a certain code and see if it works.

hj|1.25.08 @ 12:31PM|#

Sorry, I didn't see where Episiarch had already answered the question.

T|1.25.08 @ 12:41PM|#

aspects of our individuality are in the typographical errors...

Can I use that defense with my written expression as well? My typos make me the precious, unique, individual I am? Because if that's the case, I'm gonna quit wasting my time spell-checking and editing for typos.

The extra 30 seconds a day will come in handy, too.

PickyHippie|1.25.08 @ 12:52PM|#

"Naturally, anti-technology and anti-corporate activist groups are calling for a moratorium on the research."

We prefer "Luddite and Pinko" thankyouverymuch.

|1.25.08 @ 12:53PM|#

:-D Warty, if only I had...

The Wine Commonsewer|1.25.08 @ 12:58PM|#

Thunk.

[Sound of TWC being blown off his stool (no pigeon) by Bronwyn's amazing comment].

Wow.

Pretty cool.

The Wine Commonsewer|1.25.08 @ 1:01PM|#

We prefer "Luddite and Pinko" thankyouverymuch.

That's cuz you went to college. Some of us prefer the term dumb ass.

|1.25.08 @ 1:11PM|#

Well T, seeing as how the typographical errors in your genome are the fault of your forebears, I don't see how you can use your own poor typing as the key to your Self as a Special and Unique Snowflake.

Just blame your parents :)

|1.25.08 @ 1:15PM|#

My algebra II teacher in boarding school used to call us troglodytes and philistines.

He also gave us vocabulary tests. Funny fellow, that Mr. Bonnano.

I hope you didn't bump your noggin on the way down, TWC. *helps him up*

PickyHippie|1.25.08 @ 1:22PM|#

"Some of us prefer the term dumb ass."

Words hurt, TWC! I'm telling John Edwards! You're so going to get it!

[Puts on Birkenstocks and gets in Prius]

T|1.25.08 @ 1:28PM|#

Just blame your parents :)

I would, but my older sister has a lock on that approach in the family. She even blames them for me.

Mike Laursen|1.25.08 @ 1:29PM|#

Certainly not all humans. Have you given a sample?

Well, not knowingly, but late at night some hunch-backed gene sequencing lab worker may have gone through my trash and picked out my used Kleenex or something.

|1.25.08 @ 1:38PM|#

T, you could always be more specific and blame their gonadal tissues.

Your mother carried her "half" of you when she was still in utero so I suppose you could blame your maternal grandmother.

As for your dad, he just experienced a specific meiotic event - billions of them, I'm sure - and you were just lucky to draw the product of one of the less accurate events.

I hope this helps.

|1.25.08 @ 1:46PM|#

Any speculation on what Venter's encoded message may say?

"James Watson is a prick."

Ska|1.25.08 @ 1:51PM|#

|1.25.08 @ 3:11PM|#

coded message: "Watson-Crick, come here, I need you"

|1.25.08 @ 3:38PM|#

Matt... I shortened it to "Watson is a prick" - there's no J in the amino acid code. There's no O either, but we'll work around that license plate-style.

So.

Reverse translating, using DNA codons of my choosing (the code is redundant) we'd have:

TGGGCTACTTCTAATATTTCTGCTCCTCGTATTTGTAAA

No spaces, no O, but there you go.

|1.25.08 @ 5:07PM|#

Ron:

They have not yet installed this lab-created genome into a bacterial cell to see if it will boot up.

What kind of bacterial cell? The same Mycoplasma genitalium? If so, and it boots up (which would be bitchen cool), maybe they could also install it in a different but closely related bacterial cell and then try to determine what different parts of that host cell's genome code for. Perhaps they could determine this by having a closely related host cell that allows the genome to boot up and a not so closely related host cell that does not.

BTW Ron, "boot up" is kinda cool in this context. Did you come up with that or is it currently lingua franca in the genetics/biology community?

|1.25.08 @ 5:11PM|#

Any speculation on what Venter's encoded message may say?

"Ha ha, we beat the government-Yea!!"

|1.25.08 @ 10:04PM|#

Any speculation on what Venter's encoded message may say?"

He sold advert rights. It is a red tag that says "Levis"

Reason Magazine

Get Reason E-mail Updates!

Site comments/questions:

Media Inquiries and Reprint Permissions:

Editorial & Production Offices:

advertisements