Reason Magazine

Print|Email

Coming in 2009: The $5,000 Genome

Wondering what to get that special someone for Christmas? Perhaps a gift certificate from the third-generation human genome sequencing company Complete Genomics Inc. The Silicon Valley startup announced that it will be offering to sequence people's entire genomes for just $5,000 by the second quarter of 2009. As the San Jose/Silicon Valley Business Journal reports:

“We will be the first company to sequence complete human genomes for less than $1,000 in material costs,” said CEO Clifford Reid. “This breakthrough materials cost, combined with our low per-genome instrument, labor and overhead costs, will allow us to offer complete human genomes for just $5,000 in Q2 2009.”

The company also said it intends to open additional genome sequencing centers across the U.S. and abroad. Over the next five years, the company projects that 10 such centers will be able to sequence 1 million complete human genomes.

I have had a genotype scan by 23andMe (and I'll be revealing all my known genetic flaws to reason readers soon). If the folks at Complete Genomics decide to go for the $10 million Archon X Prize for Genomics and need any volunteers for genomes to sequence, I'm very available.

Ain't the 21st Century grand?! 

Editor's Note: We invite comments and request that they be civil and on-topic. We do not moderate or assume any responsibility for comments, which are owned by the readers who post them. Comments do not represent the views of Reason.com or Reason Foundation. We reserve the right to delete any comment for any reason at any time.

|10.7.08 @ 12:07PM|

"This breakthrough materials cost, combined with our low per-genome instrument, labor and overhead costs, will allow us to offer complete human genomes for just $5,000 in Q2 2009."

Get a marketing expert. $4995 is a much more attractive price.

|10.7.08 @ 12:17PM|

Ron,

It's your decision obviously, and I am keen to know all your genetic flaws, but you might not want to publish the results. Insurance and all of that...

|10.7.08 @ 12:18PM|

You know, Ron, you wear a hat, and you have a job, and you bring home the bacon, so no one knows. So maybe you shouldn't out yourself.

|10.7.08 @ 12:35PM|

I still think he wants to do us

|10.7.08 @ 12:40PM|

If they could print it all out on a T-shirt, they attract more business.

|10.7.08 @ 12:53PM|

ATCGAAGCTCTATAGCATTAATCGC

Man, that should make the chicks come running.

yeah|10.7.08 @ 12:56PM|

I got a 23andme scan, and was underwhelmed by the results. Plz share your profile to make it better for everyone.

BTW I have great episodic memory according to 23andme,

LarryA|10.7.08 @ 1:01PM|

If they really want to make money they need to figure out how to tell if two genomes are compatible with each other.

|10.7.08 @ 1:15PM|

...combined with our low per-genome instrument, labor and overhead costs...

Mexican Illegals?

|10.7.08 @ 1:27PM|

Did anyone catch this NYT article on trendy genome testing? Sounds like a very unattractive activity for a party; spit into a cup and find out who's getting cancer!

|10.7.08 @ 1:36PM|

spit into a cup and find out who's getting cancer!

"Linda - you didn't tell me you were predisposed to being attracted to women. This changes our relationship completely! I wasn't going to ask before, but now... well... since apparently Jill is too... *wink**wink*"

|10.7.08 @ 1:36PM|

Sounds like a very unattractive activity for a party; spit into a cup

You could have stopped at "cup."

|10.7.08 @ 1:50PM|

LarryA:
If they really want to make money they need to figure out how to tell if two genomes are compatible with each other.

Can you say "Major Histocompatibility Complex"? ;-)

|10.7.08 @ 1:54PM|

"Linda - you didn't tell me you were predisposed to being attracted to women. This changes our relationship completely! I wasn't going to ask before, but now... well... since apparently Jill is too... *wink**wink*"

Ha! Then this kind of important information shouldn't remain hidden until our thirties. I predict it will eventually become an integral part of freshman orientation.

|10.7.08 @ 2:00PM|

If they really want to make money they need to figure out how to tell if two genomes are compatible with each other.

I had a smartass response to that, but Ron Bailey's set the bar way too high.

D.A. Ridgely|10.7.08 @ 2:56PM|

It's your decision obviously, and I am keen to know all your genetic flaws, but you might not want to publish the results. Insurance and all of that...

OTOH, if Mr. Bailey doesn't report the findings, the IRS may not let him deduct the cost as a business expense.

Leave a Comment

advertisements

Get Reason E-mail Updates!

Manage your Reason e-mail list subscriptions

Site comments/questions:

Media Inquiries and Reprint Permissions:


(310) 367-6109

Editorial & Production Offices:

3415 S. Sepulveda Blvd.
Suite 400
Los Angeles, CA 90034
(310) 391-2245